다중 역전사-루프매개등온증폭법(RT-LAMP)를 이용한 생물 독소 유전자 신속 진단법

Rapid, Simultaneous Detection of Various Biological Toxin Genes Using Multiplex Reverse Transcription Loop-Mediated Isothermal Amplification(RT-LAMP)

Article information

J. KIMS Technol. 2024;27(4):516-527

Publication date (electronic) : 2024 August 05

doi : https://doi.org/10.9766/kimst.2024.27.4.516

Seungho Lee ^a^,¹⁾, Chanho Chung ^a^,¹⁾, Sehun Gu ¹⁾, Jungeun Kim ¹⁾, Hyeongseok Yun ¹⁾, Daesang Lee ¹⁾, Gyeunghaeng Hur ¹⁾, Donghyun Song ¹⁾^,

¹⁾Advanced Defense Science & Technology Research Institute - Chem-Bio Technology Center, Agency for Defense Development, Korea

이승호^a^,¹⁾, 정찬호^a^,¹⁾, 구세훈¹⁾, 김정은¹⁾, 윤형석¹⁾, 이대상¹⁾, 허경행¹⁾, 송동현¹⁾^,

¹⁾국방과학연구소 국방첨단과학기술연구원 Chem-Bio센터

^*Corresponding author, E-mail: swpia@add.re.kr

aThe authors have equally contributed

Received 2023 December 6; Revised 2024 May 10; Accepted 2024 May 13.

Trans Abstract

Rapid, early, accurate detection and identification of the various pathogenic agents associated with the development of biological weapons is critical in preventing loss of life and limiting the impact of these organisms when used against civilian or military targets. The aim of this study was to produce a system for the simple, rapid, accurate and simultaneous detection and identification of Ricin, Botulinum toxin B and Staphylococcal enterotoxin B as a proof of principle for developing field appropriate reverse transcription loop-mediated isothermal amplification systems for the accurate identification of potential biological threats. These systems were designed to facilitate the identification of potential threats even in remote or resource-limited locations.

Keywords: Pathogenic Agents(병원성 작용제); BoNT-B(보툴리눔 B); SEB(포도상구균 장 독소 B); RT-LAMP(역전사-루프매개등온증폭법)

1. 서 론

생물학작용제는 무기화되어 대량 살상을 유발하는데에 사용될 수 있는 병원성 및 독성 물질이다^[1]. 이러한 작용제의 사용은 전에는 드물었지만, 증가하는 세계적 불안정성과 생물 기술의 급속한 발전으로 인해 생물학 무기로 활용될 가능성이 높아지면서 국가적인 관심사가 되고 있다. 생물학작용제의 위협은 낮은 가시성, 높은 위험효과, 쉬운 접근성 및 감염성과 같은 고유한 특징을 가지고 있기 때문에, 빠르고 정확한 식별 방법을 개발하는 것이 중요하다^[2,3]. 현재 이러한 병원체와 독소를 검출할 수 있는 많은 방법이 개발되어 있다. 하지만 대부분 미생물 실험 평가 또는 면역학적 방법으로 이루어져 있고, 일부는 일반적인 중합효소 연쇄 반응(Polymerase Chain Reaction, PCR)과 같은 유전자 식별 기술에 중점을 둔 방법이었다^[4]. 배양 과정을 이용한 방법은 높은 선택성과 민감도가 있지만, 선택적 플레이팅과 농축이 필요하고 상당한 시간과 노력이 필요하다^[5,6]. 면역학적 검출 기술은 기존 미생물 실험 평가보다 적은 준비 시간이 필요하지만, 종종 비특이적 결합으로 인해 높은 위양성률을 보이고, 유기체의 생존력을 나타낼 수 없다^[7]. PCR은 진단 속도와 병원체 DNA의 단일 카피도 증폭하여 복제할 수 있는 능력으로 인해 생물학적 위협 식별의 golden standard로 간주 된다. 그러나 PCR은 장비와 시약에 들어가는 비용이 많고, 유연하게 제어되지 않는 온도 순환의 필요성, 숙련된 인력이 광범위하고 시간 소모적인 RNA 정제 단계를 수행하는 등 몇 가지 단점을 가지고 있어서 현장 진단에 적합하지 않다^[8,9]. 그러나 최근 등온 증폭 기술 개발은 핵산 증폭을 용이하게 하기 위한 정확한 온도 변환이 필요하지 않기 때문에 현장 진단에서의 적용에 상당한 관심을 불러일으켰다. 이 기술은 적은 전력을 필요로 하여 휴대용 현장 진단 장비와 호환이 가능하다^[10-12]. 루프 매개 등온 증폭(Loop-mediated isothermal amplification, LAMP)은 PCR과 같은 이미 확립된 증폭 방법에 비해 간단하고 저렴한 대안을 제공하는 새로운 핵산 증폭 방법이다^[13]. LAMP는 높은 민감도, 특이성 및 신속성을 특징으로 하므로 현장 진단 기술에 이상적인 방법이다^[14,15]. 생물학작용제 중 독소는 분리와 식별이 어렵고, 환경에 전파 시 더욱 복잡한 상황을 초래한다. 미국 질병통제예방센터(Center for Disease Control and prevention, CDC)는 생물학전에 대한 주요 위협 독소로 보툴리눔 독소(Botulinum toxin, BoNT), 클로스트리디움 퍼프린젠스의 엡실론 독소, 리신 독소(Ricin) 및 포도상구균 장독소 B(Staphylococcal enterotoxin B, SEB)를 언급했다^[16,17]. 이로 인해서 이러한 독소를 특이적으로 검출하는 새로운 검출 방법이 개발되었지만, 여러 가지 복잡한 이종 혼합물로 인해 진단이 어려운 단점이 있다. 이러한 복잡성을 해결하기 위해서는 더 명확하고, 민감도가 높은 방법을 사용해야 한다. 단일 반응에서 여러 대상의 독소를 동시 평가하는데 용이한 다중 분석 기술은 동일한 반응 내에서 추정되는 여러 독소에 대한 양성 및 음성 결과를 모두 확인할 수 있다^[18-21]. 이 연구는 단일 반응에서 Ricin, BoNT-B 및 SEB의 3가지 독소에 대해서 신속한 진단 및 동시 식별을 위한 RT-LAMP 기반 분석 기술에 대한 연구개발 내용을 기술하고 있다.

2. 방 법

프라이머와 프로브는 Ricin, BoNT-B 및 SEB의 코딩서열과 PrimerExplorer V5(HTTP://primerexploer.jp/e/)를 사용하여 Ricin, BoNT-B 및 SEB에 특이적인 세 가지 프라이머 세트로 설계하였다. 각 프라이머 세트는 6개의 프라이머(F3, B3, FIP, BIP, LF 및 LB)로 구성되어있으며 inner부터 outer 프라이머까지의 비율(2:2:1.75:1.75:5:2:3과 2:2:8:8:4:2:2)을 비교하고, 고정된 온도(55 ℃부터 65 ℃)에서 RT-LAMP 장비를 사용하여 증폭 곡선을 확인하여 반응성과 감도를 비교하여 최적화하였다. 프라이머 세트의 정보는 Table 1에 나와 있다. 각 독소에는 레이블로 지정된 LBP 프라이머(5′-형광(Ricin: Cy5, BoNT-B: Hex 및 SEB: FAM)가 있다. LBP 프라이머는 다중 반응에서 가닥 변위 프로브로 작용하고, LBP 시퀀스에 특정한 2개의 소광체 프로브(QP1 및 QP2)가 추가되어 비특이적 반응성을 방지한다. 또한 각 LBP 프라이머는 루프 영역(LB) 서열, 내부 스페이서 및 상보적 소광체 프로브 결합 서열을 포함하여 분석 시에 특정 활성을 촉진하는 역할을 한다^[18-21]. 모든 RT-LAMP 실험은 WarmStrart LAMP kit (NEB InC., USA)와 자체적으로 구축한 프라이머 농도 비율과 템플릿 농도를 이용하였다. 반응물의 조성은 2 uM의 F3과 B3, 8 uM의 FIP와 BIP, 4 uM의 LF, 2 uM 의 LB와 LBP, 10X quencher probe mix(4 μM quencher 1 solution, 2 μM quencher 2 solution), 1X Isothermal buffer(10 mM Tris, pH 7.5, 50 mM NaCl, 1 mM EDTA)에서 구성 요소들을 annealing 하여 올리고뉴클레오티드를 heating block에서 2분 동안 변성시킨 후 25 ℃에서 천천히 냉각했다. RT-LAMP의 경우, WarmStart LAMP 2X master mix 12 uL, 10X LAMP primer mix 1 uL, 10X quencher probe mix 1 μL, nuclease-free water 9.5 μL 의 혼합물과 DNA template 1 μL를 혼합하여 사용했다. 반응 조건은 올리고뉴클레오티드를 heating block에서 95 ℃에서 2분 동안 변성시킨 후 25 ℃에서 천천히 cooling 한 후, QuantStudio 6 Real-time PCR Detection System(Applied Biosystems, USA) 장비에서 61 ℃에서 60분간 반응을 진행하였다. RT-LAMP 방법의 민감도 평가를 위하여 표준 RT-PCR 방법과 비교하였다. RT-PCR 방법은 PCR premix, primer mix 900 nmole, template cDNA, nuclease-free water를 포함한 총 20 uL 의 반응물을 95 ℃에서 10분 변성, 95 ℃에서 10초, 55 ℃에서 1분 annealing 40 cycle로 수행되었다. Ricin, BoNT-B 및 SEB를 표적으로 하는 다중 RT-LAMP 분석은 삼중 LAMP 방법의 경우 Ricin, BoNT-B 및 SEB 에 대한 세 가지 프라이머 세트로 구성된 LAMP 프라이머 mix를 사용하거나 이중 LAMP 방법에서 특정 표적 쌍에 대한 프라이머 세트의 조합을 사용하였다. 검출 한계(Limits Of Detection, LOD) 측정을 위하여 표적 유전자 DNA를 1×10³부터 1×10^-2 ng/μL 까지 10배 단계 희석하여 삼반복 시험을 수행하였다. 특이도 시험을 위해서 14개의 바이러스 핵산 시료(Hantaan virus, Seoul virus, Puumala virus, Severe acute respiratory syndrome coronavirus 2, Severe fever with thrombocytopenia syndrome virus, human coronavirus OC43, Japanese encephalitis virus, Coxsakievirus, Echovirus, Rhinovirus, Parainfluenza-type1, Plasmodium vivax-1, Plasmodium vivax-2, Plasmodium vivax-3), 20개의 박테리아 및 독소 핵산 시료(Shigella boydii, Shigella dysenteriae type I, Shigella sonnei 2009, Shigella flexneri, Salmonella enterica serovar Typhimurium, Vibrio cholerae O1, Vibrio cholerae O139, Abrin, Brucella melitensis, Francisella tularensis, Botulinum toxin type A, C, D, E, Bacillus anthracis(BA) δSterne, BA HS, BA KJ, BA Sterne, BA 14578, BA HY1) 1×10² pg/μL를 사용하였다.

Table 1.

The multiplex RT-LAMP primer sets used in this study

3. 결 과

반응 프라이머 농도 비율과 템플릿 농도는 정적 반응 매트릭스에 노출되었을 때 F3, B3, FIP, BIP, LF, LB 및 LBP가 inner부터 outer 프라이머까지의 비율(2:2:1.75:1.75:5:2:3과 2:2:8:8:4:2:2) 변화를 포함하여 반응성과 감도 최적화를 위해 수행하였다(Fig. 1).

Fig. 1.

Primer optimization of our single reaction RT-LAMP detection assays. Various concentration ratios of each of the primer sets for each of our RT-LAMP assays were evaluated, including changes in the forward: reverse primer ratios for the F3, B3, FIP, BIP, LF, LB and LBP. a) 2:2:1.75:1.75:5:2:3 and b) 2:2:8:8:4:2:2. Red, green, and blue lines indicate Ricin, BoNT-B, and SEB, respectively. ∆Rn(delta Rn): The magnitude of the signal generated under specific PCR conditions, threshold values: The level of determined by the a average standard deviation of Rn during the initial PCR cycles, modified by a factor, and positioned within the exponential amplification phase of PCR products

결과는 2:2:8:8:4:2:2 비율 혼합이 빠른 반응 속도(임계 값 도달까지의 짧은 시간)와 안정적인 그래프를 보여주었다. 템플릿 농도에 대한 평가는 템플릿이 너무 많은 경우 위양성(false positive)이 발생하고 증폭 효율이 감소할 수 있음이 확인되었다^[22,23]. 반응온도 최적 조건은 55 ℃부터 65 ℃까지 범위로 증폭 곡선과 함께 평가하였다. Ricin을 이용하여 최적 반응온도가 57 ℃에서 63 ℃까지 증폭이 가능한 것으로 확인하였다(Fig. 2). 이 데이터를 세부적으로 분석한 결과 증폭 효율이 57 ℃ ∼ 61 ℃에서 점진적으로 증가한 다음 61 ℃ ∼ 63 ℃에서 감소하는 것으로 확인되었다. 또한, 음성 대조군에서는 더 높은 증폭 온도(63 ℃ ∼ 65 ℃)에서 위양성이 약간 증가하고 전반적인 증폭 안정성 및 정확도가 감소하는 것으로 확인되었다. 위의 결과를 통하여 61 ℃의 반응온도가 모든 LAMP 프라이머 세트에서 가장 신뢰할 수 있고 정확한 결과를 보여주는 이상적인 증폭 조건인 것을 확인하였다.

Fig. 2.

Optimizing RT-LAMP assay temperature. Different temperatures(55–65 ℃ at 2 ℃ intervals, a) 55 ℃, b) 57 ℃, c) 59 ℃, d) 61 ℃, e) 63 ℃ and f) 65 ℃) were tested and 61 ℃ was chosen as the optimal temperature for LAMP amplification. ∆Rn(delta Rn): The magnitude of the signal generated under specific PCR conditions, threshold values: The level of determined by the a average standard deviation of Rn during the initial PCR cycles, modified by a factor, and positioned within the exponential amplification phase of PCR products

표적 유전자를 증폭하기 위해 단일 온도를 사용하는 LAMP 증폭은 임상 시료에서 발견되는 억제제에 의한 영향이 적은 것으로 알려져 있다^[24,25]. Ricin, BoNT-B 및 SEB 유전자 RT-LAMP의 민감도는 10³ pg/μL 에서 10^-2 pg/μL로 희석된 Ricin, BoNT-B 및 SEB 유전자 템플릿을 등온 증폭하여 평가하고 증류수 음성 대조군과 비교했다(Fig. 3). 이 평가는 최적의 조건에서 개발된 프로브 분석이 모두 매우 민감하여 매우 짧은 시간에 정확한 결과를 나타낸다는 것이 확인되었다. RT-LAMP 분석은 3가지 독소에 대해서 10^-1 pg/μL만큼 적은 양을 1시간 이내에 증폭할 수 있었다. LAMP의 표준 곡선은 높은 수준의 효능과 민감도를 나타냈다(R² > 0.96 Ricin, R² > 0.99 BoNT-B 및 R² > 0.98 SEB). Ricin, BoNT-B 및 SEB 표적에 대한 검출 한계(LOD)는 각각 1.2×10^-2 pg/μL, 5.0×10^-3 pg/μL 및 1.7×10^-4 pg/μL 로 확인되었다. RT-LAMP 분석은 매우 높은 감도(일반적으로 기존 RT-PCR 방법보다 10∼1,000배 더 높음)와 빠른 검출 속도가 장점으로 알려져 있으며, 두 가지 조건은 현장 진단 환경에서 중요하다^[26-28]. 본 연구 결과에서도 RT-LAMP와 RT-PCR과 비교하였을 때 RT-LAMP가 높은 민감도와 빠른 진단 시간의 장점을 보여주었다(Table 2). RT-LAMP는 표적 DNA의 농도가 1.2×10^-2 pg/μL부터 1.7×10^-4 pg/μL인 조건에서 일정한 온도에서 20∼40분 내 검출이 가능했지만, RT-PCR의 경우 DNA 농도 8.5×10⁰ pg/μL부터 4.4×10^-1 pg/μL를 검출하는데 약 2∼3시간(40 cycle)이 소요되었다. 각 실험에는 표준 DNA 템플릿을 사용하여 분석의 교차 반응 가능성을 배제했다. 프라이머의 분석 특이성에 사용한 시료들은 Table 3에 요약하여 정리하였다. Ricin, BoNT-B 및 SEB 외에도 36가지 바이러스, 박테리아 및 독소 핵산(1×10² pg/μL)이 포함되어 있다. 하나의 샘플 튜브에 포함된 36가지의 병원체 핵산 샘플 중에서 Ricin, BoNT-B 및 SEB에 대해서만 반응을 나타냈다. 이러한 결과를 통하여 본 연구의 분석법의 높은 특이성을 확인하였다.

Fig. 3.

Sensitivity evaluation of the RT-LAMP assay. 10-fold serial dilutions of a) Ricin, b) BoNT-B, and c) SEB templates from 10³ to 10⁻² pg/μL were tested. ∆Rn(delta Rn): The magnitude of the signal generated under specific PCR conditions, threshold values: The level of determined by the a average standard deviation of Rn during the initial PCR cycles, modified by a factor, and positioned within the exponential amplification phase of PCR products

Table 2.

Comparison RT-LAMP and RT-PCR

Table 3.

Results of cross-reactivity(specificity) of the multiplex RT-LAMP assay

다중 표적의 동시 검출은 진단 결과의 특이성과 신뢰성을 저해할 수 있다^[29,30]. 이 부분을 고려하여 핵산 가닥 교환 회로를 용이하게 하기 위해 개발된 원리를 적용하여 짧은 반 이중 올리고뉴클레오티드 가닥 변위(Oligonucleotide Strand Displacement, OSD) 프로브를 설계했다^[13,31-33]. OSD 프로브는 5′ 또는 3′ 말단에 형광 마커를 포함하는 표적 결합 프로브 및 3′ 또는 5′ 말단에서 소광체로 변형된 두 번째 올리고뉴클레오티드로 2개의 상보적 서열을 포함한다. 표적 결합 프로브는 두 번째 올리고뉴클레오티드보다 10∼11개의 더 긴 염기를 가지고 있어 표적 결합 프로브와 증폭 산물 사이의 결합 엔탈피가 높아져 표적 DNA 증폭 반응이 보다 용이하다^[34-36]. 이 증폭은 형광체와 소광체를 분리하여 형광 강도를 증가시킨다. 각 프로브는 서로 다른 염기서열을 식별하고 서로 다른 색상을 통해 나타나기 때문에 OSD 프로브는 다중 RT-LAMP 반응에 매우 적합하다. 다중 RT-LAMP를 사용하여 Ricin, BoNT-B 및 SEB 유전자를 동시에 식별하기 위해 이러한 OSD 프로브를 적용했다. Ricin 특정 OSD 프로브는 Cy5, BoNT-B 특정 OSD 프로브는 HEX, SEB 특정 OSD 프로브는 FAM으로 레이블하여 지정하였다. 프로브는 특정 열역학적 특성으로 인해 각 대상 증폭 산물에 민감하므로 높은 신호로 동일한 반응 내에서 서로 다른 대상을 구별할 수 있다. Fig. 4에서 보이는 것과 같이 OSD 프로브는 각 LAMP 대상을 개별적으로 감지하여 뚜렷한 형광 신호를 생성할 수 있다. 다중 RT-LAMP 분석은 한 개의 튜브에 Ricin(Cy5)/BoNT-B (Hex), BoNT-B(Hex)/SEB(FAM), Ricin(Cy5) SEB(FAM) 및 Ricin(Cy5)/BoNT-B(Hex)/SEB(FAM)의 조합으로 모든 대체 가능한 프로브를 사용하여 검증하였다. 다중 프라이머와 템플릿을 모두 혼합한 실험은 Ricin(Cy5)/BoNT-B(Hex)의 threshold value(Ct 값) 46.84/38.66, BoNT-B(Hex)/SEB(FAM)의 Ct 값 42.05/27.08, Ricin(Cy5)/SEB(FAM)의 Ct 값 45.25/27.13, 및 Ricin(Cy5)/BoNT-B (Hex)/SEB(FAM)의 Ct 값 43.8/34.94/28.63으로 단일 프라이머와 템플릿을 이용한 실험결과(Ricin의 Ct 값 42.05, BoNT-B의 Ct 값 38.94, SEB(FAM)의 Ct 값 26.40)에 비해서 Ct 값이 1∼4 cycle 높게 확인되어 증폭 속도가 늦은 것이 확인되었지만 분석 특이성에는 변화가 없었다. 따라서 교차 반응이나 비특이적 증폭 없이 주형과 프라이머를 혼합하여 사용하더라도 각 표적 유전자의 특이적 증폭이 가능함을 확인할 수 있었다. 또한, 음성 컨트롤 템플릿과도 뚜렷하게 구분되어 다중 타겟 방식으로 인해서 단일 타겟에 비해 민감도가 감소할 수는 있으나 양성 샘플과 음성 샘플을 명확하게 구별할 수 있는 결과를 보여준다^[37].

Fig. 4.

Multiplex capabilities of various RT-LAMP assays. Simultaneous detection of a-c) single(Ricin, BoNT-B, and SEB), d-f) duplex(Ricin and BoNT-B, Ricin and SEB, and SEB and BoNT-B), g) triplex(Ricin, BoNT-B, and SEB), h) negative targets for each of our three toxin genes was possible when using our pre-designed multiplex primer sets facilitating single assay detection. ∆Rn(delta Rn): The magnitude of the signal generated under specific PCR conditions, threshold values: The level of determined by the a average standard deviation of Rn during the initial PCR cycles, modified by a factor, and positioned within the exponential amplification phase of PCR products

4. 결 론

이러한 결과를 통하여 우리가 개발한 RT-LAMP 실험법은 정확성과 특이성을 낮추지 않고 단일 반응에서 3개의 생물학작용제를 식별하기 위해 형광체 결합 프라이머를 사용하여 다중 RT-LAMP의 유용성을 입증하였다. 본 연구의 평가에서는 각 분석 시 온도와 농도 비율의 최적화가 포함되었으며 각 LAMP 반응의 특이성과 민감도를 확인했다. 기존에 활용되고 있는 일반적인 PCR과 실시간 RT-PCR은 해당하는 필수적인 특정 장비가 필요하거나 아가로즈 젤을 통해 확인하는 등의 부가적인 시스템이 필요하므로 탐지 시간과 소요 비용이 증가한다. 한편, LAMP 검출은 일정한 온도에서 등온 반응으로 완료되어 탐지 시간이 절약된다. 이 시스템은 특히 고가의 열 순환 장비(PCR) 없이 다양한 실험실 환경에 쉽게 적용할 수 있어 소요 비용 또한 절약할 수 있다. Ricin, BoNT-B 및 SEB가 생물학작용제 모델로 사용되었으나 이 방법은 다른 세균, 바이러스 또는 독소 표적의 진단을 위해 쉽게 적용할 수 있다. 따라서 이 방법은 여러 표적이 공존할 수 있는 다중 병원체를 성공적으로 식별하여 통합 조사를 가능하게 하여 진단 비용과 시간을 줄이고 보다 정확한 감염 위협 평가 및 예방을 용이하게 할 수 있다.

후 기

본 논문은 2024년 정부의 재원으로 국방과학연구소에서 수행한 연구 결과임(912A01201).

References

[1]. . Walper Scott A., Aragones Guillermo Lasarte, Sapsford Kim E., Brown Carl W. III, Rowland Clare E., Breger Joyce C., Medintz Igor L.. Detecting Biothreat Agents: From Current Diagnostics to Developing Sensor Technologies. ACS Sensors 2018;3:1894–2024.

[2]. . Parida M. M., Dash Paban Kumar, Shukla Jyoti. Handbook on Biological Warfare Preparedness. Toxicology Elsevier; 2020. 5p. 83–102.

[3]. . Klietmann Wolfgang F., Ruoff Kathryn L.. Bioterrorism: Implications for the Clinical Microbiologist. Clinical Microbiology Reviews 2001;2:364–381.

[4]. . Alahi Md Eshrat E., Mukhopadhyay Subhas Chandra. Detection Methodologies for Pathogen and Toxins: A Review. Sensors 2017;17:1885.

[5]. . Dahling Daniel R.. Detection and enumeration of entericviruses in cell culture. Critical Reviews in Environmental Control 1991;21:237–263.

[6]. . Fong Theng-Theng, Lipp Erin K.. Enteric Viruses of Humans and Animals in Aquatic Environments: Health Risks, Detection, and Potential Water Quality Assessment Tools. Microbiology and Molecular Biology Reviews 2005;69:357–371.

[7]. . Notermans S., Wernars K.. Immunological methods for detection of foodbornepathogens and their toxins. International Journal of Food Microbiology 1991;12:91–102.

[8]. . Dwivedi Shailendra, Purohit Purvi, Misra Radhieka, Pareek Puneet, Goel Apul, Khattri Sanjay, Pant Kamlesh Kumar, Misra Sanjeev, Sharma Praveen. Diseases and Molecular Diagnostics: A Step Closer to Precision Medicine. Indian Journal of Clinical Biochemistry 2017;32:374–398.

[9]. . Engstrom-Melnyk Julia, Rodriguez Pedro L., Peraud Olivier, Hein Raymond C.. Clinical Applications of Quantitative Real-Time PCR in Virology. Methods in Microbioogy 2015;42:161–197.

[10]. . Zanoli Laura Maria, Spoto Giuseppe. Isothermal Amplification Methods for the Detection of Nucleic Acids in Microfluidic Devices. Biosensors 2013;3:18–43.

[11]. . Chang Chia-Chen, Chen Chien-Cheng, Wei Shih-Chung, Lu Hui-Hsin, Liang Yang-Hung, Lin Chii-Wann. Diagnostic Devices for Isothermal Nucleic Acid Amplification. Sensors 2012;12:8319–8337.

[12]. . Oliveira BB, Veigas B, Baptista PV. Isothermal Amplification of Nucleic Acids: The Race for the Next “Gold Standard”. Frontiers in Sensors 2021;2:1–22.

[13]. . Becherer Lisa, Borst Nadine, Bakheit Mohammed, Frischmann Sieghard, Zengerle Roland, von Stetten Felix. Loop-mediated isothermal amplification (LAMP) - review and classification of methods for sequence-specific detection. Analytical Methods 2020;12:717–746.

[14]. . Wong Y.-P., Othman S., Lau Y.-L., Radu S., Chee H.-Y.. Loop-mediated isothermal amplification (LAMP): a versatile technique for detection of micro-organisms. Journal of Applied Microbiology 2017;124:626–643.

[15]. . Augustine Robin, Hasan Anwarul, Das Suvarthi, Ahmed Rashid, Mori Yasuyoshi, Notomi Tsugunori, Kevadiya Bhavesh D., Thakor Avnesh S.. Loop-Mediated Isothermal Amplification(LAMP): A Rapid, Sensitive, Specific, and Cost-Eective Point-of-Care Test for Coronaviruses in the Context of COVID-19 Pandemic. Biology 2020;9:182.

[16]. . Berger Tamar, Eisenkraft Arik, Bar-Haim Erez, Kassirer Michael, Aran Adi Avniel, Fogel Itay. Toxins as biological weapons for terror— characteristics, challenges and medical countermeasures: a mini‑ review. Disaster and Military Medicine 2016;2:7.

[17]. . Janik Edyta, Ceremuga Michal, Saluk-Bijak Joanna, Bijak Michal. Biological Toxins as the Potential Tools for Bioterrorism. International Journal of Molecular Sciences 2019;20:1181.

[18]. . Jang Woong Sik, Lim Da Hye, Yoon Jung, Kim Ahran, Lim Minsup, Nam Jeonghun, Yanagihara Richard, Ryu Sook-Won, Jung Bo Kyeung, Ryoo Nam-Hee, Lim Chae Seung. Development of a multiplex Loop-Mediated Isothermal Amplification (LAMP) assay for on-site diagnosis of SARS CoV-2. PLoS ONE 2021;16:e0248042.

[19]. . Kim Jeeyong, Park Borae G., Lim Da Hye, Jang Woong Sik, Nam Jeonghun, Mihn Do-CiC, Lim Chae Seung. Development and evaluation of a multiplexloop-mediated isothermal amplification (LAMP) assay for differentiation of Mycobacterium tuberculosis and nontuberculosis mycobacterium in clinical samples. PLoS ONE 2021;16:e0244753.

[20]. . Zhong Lan-Lan, Zhou Qian, Tan Cui-Yan, Roberts Adam P, Ahmed Mohamed Abd El-Gawad El-Sayed, Chen Guanping, Dai Min, Yang Fan, Xia Yong, Liao Kang, Liang Yingjian, Yang Yongqiang, Feng Siyuan, Zheng Xiaobin, Tian Guo-Bao. Multiplex loop-mediated isothermal amplification (multi-LAMP) assay for rapid detection of mcr-1 to mcr-5 in colistin-resistant bacteria. Infection Drug and Resistance 2019;12:1877–1887.

[21]. . Kim Jin Hwa, Kang Minhee, Park Eunkyoung, Chung Doo Ryeon, Kim Jiyeon, Hwang Eung Soo. A Simple and Multiplex Loop-Mediated Isothermal Amplification(LAMP) Assay for Rapid Detection of SARS-CoV. BioChip Journal 2019;13:341–351.

[22]. . Park Myungsun, Won Joungha, Choi Byung Yoon, Lee C. Justin. Optimization of primer sets and detection protocols for SARS-CoV-2 of coronavirus disease 2019(COVID-19) using PCR and real-time PCR. Exprimental & Molecular Medicine 2020;52:963–977.

[23]. . Hardinge Patrick, Kiddle Guy, Tisi Laurence, Murray James A. H.. Optimised LAMP allows single copy detection of 35Sp and NOSt in transgenic maize using Bioluminescent Assay in Real Time (BART). Scientific Reports 2018;8:17590.

[24]. . Foo Phiaw Chong, Nurul Najian A. B., Muhamad Nuramin A., Ahamad Mariana, Mohamed Maizan, Yean Chan Yean, Lim Boon Huat. Loop-mediated isothermal amplification(LAMP) reaction as viable PCR substitute for diagnostic applications: a comparative analysis study of LAMP, conventional PCR, nested PCR(nPCR) and real-time PCR(qPCR) based on Entamoeba histolytica DNA derived from faecal sample. BMC Biotechnology 2020;20:34.

[25]. . Francois Patrice, Tangomo Manuela, Hibbs Jonathan, Bonetti Eve-Julie, Boehme Catharina C, Notomi Tsugunori, Perkins Mark D, Schrenzel Jacques. Robustness ofa loop-mediated isothermal amplication reaction for diagnostic applications. FEMS Immunology & Medical Microbiology 2011;62:41–48.

[26]. . Khan Mehran, Wang Rongbo, Li Benjin, Liu Peiqing, Weng Qiyong, Chen Qinghe. Comparative Evaluation of the LAMP Assay and PCR-Based Assays for the Rapid Detection of Alternaria solani. Frontiers in Microbiology 2018;9:2089.

[27]. . Amaral Catarina, Antunes Wilson, Moe Elin, Duarte Américo G., Lima Luís M. P., Santos Cristiana, Gomes Inês L., Afonso Gonçalo S., Vieira Ricardo, Teles Helena Sofa S., Reis Marisa S., Ramalho da Silva Manuel A., Henriques Ana Margarida, Fevereiro Miguel, RitaVentura M., Serranol Mónica, Pimentel Catarina. A molecular test based on RT‑LAMP for rapid, sensitive and inexpensive colorimetric detection of SARS‑CoV‑2 in clinical samples. Scientific Reports 2021;11:16430.

[28]. . Inaba Masato, Higashimoto Yuki, Toyama Yoko, Horiguchi Tomoya, Hibino Masaya, Iwata Mitsunaga, Imaizumi Kazuyoshi, Doiae Yohei. Diagnostic accuracy of LAMP versus PCR over the course of SARS-CoV-2 infection. International Journal Infectious Diseases 2021;107:195–200.

[29]. . Tombuloglu Huseyin, Sabit Hussein, Al-Suhaimi Ebtesam, Jindan Reem Al, Alkharsah Khaled R.. Development of multiplex real-time RT-PCR assay for the detection of SARS-CoV-2. PLoS ONE 2021;16:e0250942.

[30]. . Cheng Ningtao, Fu Jing. An Approach to the Simultaneous Detection of Multiple Biomarkers for the Early Diagnosis of Liver Cancer Using Quantum Dot Nanoprobes. Infectious & Microbes Diseases 2022;4:34–40.

[31]. . Liu Yichen, Lu Baiyang, Tang Yidan, Du Yan, Li Bingling. Real-time gene analysis based on a portable electrochemical microfluidic system. Electrochemistry Communications 2020;111:106665.

[32]. . Hardinge Patrick, Murray James A. H.. Reduced False Positives and Improved Reporting of Loop-Mediated Isothermal Amplification using Quenched Fluorescent Primers. Scientific Reports 2019;9:7400.

[33]. . Bhadra Sanchita, Riedel Timothy E., Lakhotia Simren, Tranc Nicholas D., Ellington Andrew D.. High-Surety Isothermal Amplification and Detection of SARS-CoV-2. mSphere 2021;6:e00911–20.

[34]. . Jiang Yu Sherry, Bhadra Sanchita, Li Bingling, Wu Yuefeng Rose, Milligan John N., Ellington Andrew D.. Robust Strand Exchange Reactions for the Sequence-Specific, Real-Time Detection of Nucleic Acid Amplicons. Analytical Chemistry 2015;87:3314–3320.

[35]. . Bonnet Grégoire, Tyagi Sanjay, Libchaber Albert, Kramer Fred Russell. Thermodynamic basis of the enhanced specificity of structured DNA probes. Proceedings of the National Academy of Sciences of the United States of America 1999;96:6171–6176.

[36]. . Tsourkas Andrew, Behlke Mark A., Rose Scott D., Bao Gang. Hybridization kinetics and thermodynamics of molecular beacons. Nucleic Acids Research 2003;31:1319–1330.

[37]. . Zhang Yinhua, Tanner Nathan A. Development of Multiplexed Reverse-Transcription Loop-Mediated Isothermal Amplification for Detection of SARS-CoV-2 and Influenza Viral RNA. BioTechniques 2021;70:167–174.

Article information Continued

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Toxin (target)	Name	Sequences (5’ to 3’)	Length (mer)
Ricin	Ricin_F3	CTTCCTACTAATAATACACAACCTT	25
	Ricin_B3	TGTTTCCCGTATATTAGAATCAC	23
	Ricin_FIP	AGTCCTCTATCCATACTTGTCCACTGACAACCATTGTTGGGCTA	44
	Ricin_BIP	GCAGTGAAAAGGCTGAACAACAGTGTAAGGCAATTATCTCGGTT	44
	Ricin_LF	TGCTTGCAAGCACAGAC	17
	Ricin_LB	TGGGCTCTTTATGCAGATG	19
	Ricin_LBP	Cy5-GTCAGTGCAGGCTCCCGTGTTAGGACGAGGGTAGGGTAGGTGGGCTC TTTATGCAGATG	55
BoNT-B	BoNT-B_F3	GCCAGTTTTAAATGAAAATGAGAC	24
	BoNT-B_B3	CTACTTTAATGCCATATAATCCATG	25
	BoNT-B_FIP	GCTTACATATTCTGGGCAAAACTTCAAAATCATTTTGCATCAAGGGA	47
	BoNT-B_BIP	TGTTCAAGAAAACAAAGGCGAGTTTCATGCATTAATATCAAGGC	44
	BoNT-B_LF	CATTATACCCCCGAAGCCT	19
	BoNT-B_LB	AGTATATTTAATAGACGTGG	20
	BoNT-B_LBP	HEX-CGGGCCCGTACAAAGGGAACACCCACACTCGTAGGAGTATATTTAA TAGACGTGG	55
SEB	SEB_F3	GTTCGGGTATTTGAAGATGG	20
	SEB_B3	CAAATTTATCTCCTGGTGCA	20
	SEB_FIP	CACCAAATAGTGACGAGTTAGGTAAGACGTACAAACTAATAAGAAAAAG	49
	SEB_BIP	ACTCTATGAATTTAACAACTCGCCTGTCATACCAAAAGCTATTCTCAT	48
	SEB_LF	TCTAATTCTTGAGCAGTCAC	20
	SEB_LB	TATGAAACGGGATATATTAAATTTATAG	28
	SEB_LBP	CGGGCCCGTACAAAGGGAACACCCACACTCGTAGGGTATGAAACGGGAT ATATTAAATTTATAG	55
Quencher Probe	BHQ_Probe_1	GAGTGTGGGTGTTCCCTTTGTACGGGCCCG-BHQ1	24
Quencher Probe	BHQ_Probe_2	CCTACCCTCGTCCTAACACGGGAGCCTGCACTGAC-BHQ2	25

property man	RT-LAMP		RT-PCR
Sensitivity (LOD)	Ricin	1.2 × 10^-2 pg/μL	Ricin	8.5 × 10⁰ pg/μL
	BoNT-B	5.0 × 10^-3 pg/μL	BoNT-B	2.6 × 10^-1 pg/μL
	SEB	1.7 × 10^-4 pg/μL	SEB	4.4 × 10^-1 pg/μL
Detection time	Rapid (requires less than 1 hr)		Slow (requires approximately 2∼3 hrs)
Temperature conditions	Constant temperature (55-65 ℃)		Variable temperature
Cost	Cost-effective		Expensive

No	Sample	Type	LAMP mix
1	HTNV_76-118	RNA	Undetermined
2	SEOV_80-39	RNA	Undetermined
3	PUUV_sotkamo	RNA	Undetermined
4	SARS-CoV-2	RNA	Undetermined
5	SFTSV	RNA	Undetermined
6	hCoV-OC43	RNA	Undetermined
7	JEV	RNA	Undetermined
8	CoxsakieV	RNA	Undetermined
9	EchoV	RNA	Undetermined
10	RhinoV	RNA	Undetermined
11	Parainfluenza-type1	RNA	Undetermined
12	Plasmodium vivax-1	RNA	Undetermined
13	Plasmodium vivax-2	RNA	Undetermined
14	Plasmodium vivax-3	RNA	Undetermined
15	Shigella sonnei 22530	gDNA	Undetermined
16	Shigella boydii	gDNA	Undetermined
17	Shigella dysenteriae type I	gDNA	Undetermined
18	Shigella sonnei 2009	gDNA	Undetermined
19	Shigella flexneri	gDNA	Undetermined
20	Salmonella enterica Serovar Typhimurium	gDNA	Undetermined
21	Vibrio cholerae O1	gDNA	Undetermined
22	Vibrio cholerae O139	gDNA	Undetermined
23	Abrin	gDNA	Undetermined
24	Brucella melitensis	gDNA	Undetermined
25	Francisella tularensis	gDNA	Undetermined
26	Botulinum toxin type A (BoNT/A)	gDNA	Undetermined
27	Bont/C	gDNA	Undetermined
28	Bont/D	gDNA	Undetermined
29	Bont/E	gDNA	Undetermined
30	Bacillus anthracis (BA) δSterne	gDNA	Undetermined
31	BA HS	gDNA	Undetermined
32	BA KJ	gDNA	Undetermined
33	BA Sterne	gDNA	Undetermined
34	BA 14578	gDNA	Undetermined
35	BA HY1	gDNA	Undetermined
36	NTC		Undetermined