J. KIMS Technol Search

CLOSE


J. KIMS Technol > Volume 27(4); 2024 > Article
다중 역전사-루프매개등온증폭법(RT-LAMP)를 이용한 생물 독소 유전자 신속 진단법

Abstract

Rapid, early, accurate detection and identification of the various pathogenic agents associated with the development of biological weapons is critical in preventing loss of life and limiting the impact of these organisms when used against civilian or military targets. The aim of this study was to produce a system for the simple, rapid, accurate and simultaneous detection and identification of Ricin, Botulinum toxin B and Staphylococcal enterotoxin B as a proof of principle for developing field appropriate reverse transcription loop-mediated isothermal amplification systems for the accurate identification of potential biological threats. These systems were designed to facilitate the identification of potential threats even in remote or resource-limited locations.

서 론

생물학작용제는 무기화되어 대량 살상을 유발하는데에 사용될 수 있는 병원성 및 독성 물질이다[1]. 이러한 작용제의 사용은 전에는 드물었지만, 증가하는 세계적 불안정성과 생물 기술의 급속한 발전으로 인해 생물학 무기로 활용될 가능성이 높아지면서 국가적인 관심사가 되고 있다. 생물학작용제의 위협은 낮은 가시성, 높은 위험효과, 쉬운 접근성 및 감염성과 같은 고유한 특징을 가지고 있기 때문에, 빠르고 정확한 식별 방법을 개발하는 것이 중요하다[2,3]. 현재 이러한 병원체와 독소를 검출할 수 있는 많은 방법이 개발되어 있다. 하지만 대부분 미생물 실험 평가 또는 면역학적 방법으로 이루어져 있고, 일부는 일반적인 중합효소 연쇄 반응(Polymerase Chain Reaction, PCR)과 같은 유전자 식별 기술에 중점을 둔 방법이었다[4]. 배양 과정을 이용한 방법은 높은 선택성과 민감도가 있지만, 선택적 플레이팅과 농축이 필요하고 상당한 시간과 노력이 필요하다[5,6]. 면역학적 검출 기술은 기존 미생물 실험 평가보다 적은 준비 시간이 필요하지만, 종종 비특이적 결합으로 인해 높은 위양성률을 보이고, 유기체의 생존력을 나타낼 수 없다[7]. PCR은 진단 속도와 병원체 DNA의 단일 카피도 증폭하여 복제할 수 있는 능력으로 인해 생물학적 위협 식별의 golden standard로 간주 된다. 그러나 PCR은 장비와 시약에 들어가는 비용이 많고, 유연하게 제어되지 않는 온도 순환의 필요성, 숙련된 인력이 광범위하고 시간 소모적인 RNA 정제 단계를 수행하는 등 몇 가지 단점을 가지고 있어서 현장 진단에 적합하지 않다[8,9]. 그러나 최근 등온 증폭 기술 개발은 핵산 증폭을 용이하게 하기 위한 정확한 온도 변환이 필요하지 않기 때문에 현장 진단에서의 적용에 상당한 관심을 불러일으켰다. 이 기술은 적은 전력을 필요로 하여 휴대용 현장 진단 장비와 호환이 가능하다[10-12]. 루프 매개 등온 증폭(Loop-mediated isothermal amplification, LAMP)은 PCR과 같은 이미 확립된 증폭 방법에 비해 간단하고 저렴한 대안을 제공하는 새로운 핵산 증폭 방법이다[13]. LAMP는 높은 민감도, 특이성 및 신속성을 특징으로 하므로 현장 진단 기술에 이상적인 방법이다[14,15]. 생물학작용제 중 독소는 분리와 식별이 어렵고, 환경에 전파 시 더욱 복잡한 상황을 초래한다. 미국 질병통제예방센터(Center for Disease Control and prevention, CDC)는 생물학전에 대한 주요 위협 독소로 보툴리눔 독소(Botulinum toxin, BoNT), 클로스트리디움 퍼프린젠스의 엡실론 독소, 리신 독소(Ricin) 및 포도상구균 장독소 B(Staphylococcal enterotoxin B, SEB)를 언급했다[16,17]. 이로 인해서 이러한 독소를 특이적으로 검출하는 새로운 검출 방법이 개발되었지만, 여러 가지 복잡한 이종 혼합물로 인해 진단이 어려운 단점이 있다. 이러한 복잡성을 해결하기 위해서는 더 명확하고, 민감도가 높은 방법을 사용해야 한다. 단일 반응에서 여러 대상의 독소를 동시 평가하는데 용이한 다중 분석 기술은 동일한 반응 내에서 추정되는 여러 독소에 대한 양성 및 음성 결과를 모두 확인할 수 있다[18-21]. 이 연구는 단일 반응에서 Ricin, BoNT-B 및 SEB의 3가지 독소에 대해서 신속한 진단 및 동시 식별을 위한 RT-LAMP 기반 분석 기술에 대한 연구개발 내용을 기술하고 있다.

방 법

프라이머와 프로브는 Ricin, BoNT-B 및 SEB의 코딩서열과 PrimerExplorer V5(HTTP://primerexploer.jp/e/)를 사용하여 Ricin, BoNT-B 및 SEB에 특이적인 세 가지 프라이머 세트로 설계하였다. 각 프라이머 세트는 6개의 프라이머(F3, B3, FIP, BIP, LF 및 LB)로 구성되어있으며 inner부터 outer 프라이머까지의 비율(2:2:1.75:1.75:5:2:3과 2:2:8:8:4:2:2)을 비교하고, 고정된 온도(55 ℃부터 65 ℃)에서 RT-LAMP 장비를 사용하여 증폭 곡선을 확인하여 반응성과 감도를 비교하여 최적화하였다. 프라이머 세트의 정보는 Table 1에 나와 있다. 각 독소에는 레이블로 지정된 LBP 프라이머(5′-형광(Ricin: Cy5, BoNT-B: Hex 및 SEB: FAM)가 있다. LBP 프라이머는 다중 반응에서 가닥 변위 프로브로 작용하고, LBP 시퀀스에 특정한 2개의 소광체 프로브(QP1 및 QP2)가 추가되어 비특이적 반응성을 방지한다. 또한 각 LBP 프라이머는 루프 영역(LB) 서열, 내부 스페이서 및 상보적 소광체 프로브 결합 서열을 포함하여 분석 시에 특정 활성을 촉진하는 역할을 한다[18-21]. 모든 RT-LAMP 실험은 WarmStrart LAMP kit (NEB InC., USA)와 자체적으로 구축한 프라이머 농도 비율과 템플릿 농도를 이용하였다. 반응물의 조성은 2 uM의 F3과 B3, 8 uM의 FIP와 BIP, 4 uM의 LF, 2 uM 의 LB와 LBP, 10X quencher probe mix(4 μM quencher 1 solution, 2 μM quencher 2 solution), 1X Isothermal buffer(10 mM Tris, pH 7.5, 50 mM NaCl, 1 mM EDTA)에서 구성 요소들을 annealing 하여 올리고뉴클레오티드를 heating block에서 2분 동안 변성시킨 후 25 ℃에서 천천히 냉각했다. RT-LAMP의 경우, WarmStart LAMP 2X master mix 12 uL, 10X LAMP primer mix 1 uL, 10X quencher probe mix 1 μL, nuclease-free water 9.5 μL 의 혼합물과 DNA template 1 μL를 혼합하여 사용했다. 반응 조건은 올리고뉴클레오티드를 heating block에서 95 ℃에서 2분 동안 변성시킨 후 25 ℃에서 천천히 cooling 한 후, QuantStudio 6 Real-time PCR Detection System(Applied Biosystems, USA) 장비에서 61 ℃에서 60분간 반응을 진행하였다. RT-LAMP 방법의 민감도 평가를 위하여 표준 RT-PCR 방법과 비교하였다. RT-PCR 방법은 PCR premix, primer mix 900 nmole, template cDNA, nuclease-free water를 포함한 총 20 uL 의 반응물을 95 ℃에서 10분 변성, 95 ℃에서 10초, 55 ℃에서 1분 annealing 40 cycle로 수행되었다. Ricin, BoNT-B 및 SEB를 표적으로 하는 다중 RT-LAMP 분석은 삼중 LAMP 방법의 경우 Ricin, BoNT-B 및 SEB 에 대한 세 가지 프라이머 세트로 구성된 LAMP 프라이머 mix를 사용하거나 이중 LAMP 방법에서 특정 표적 쌍에 대한 프라이머 세트의 조합을 사용하였다. 검출 한계(Limits Of Detection, LOD) 측정을 위하여 표적 유전자 DNA를 1×103부터 1×10-2 ng/μL 까지 10배 단계 희석하여 삼반복 시험을 수행하였다. 특이도 시험을 위해서 14개의 바이러스 핵산 시료(Hantaan virus, Seoul virus, Puumala virus, Severe acute respiratory syndrome coronavirus 2, Severe fever with thrombocytopenia syndrome virus, human coronavirus OC43, Japanese encephalitis virus, Coxsakievirus, Echovirus, Rhinovirus, Parainfluenza-type1, Plasmodium vivax-1, Plasmodium vivax-2, Plasmodium vivax-3), 20개의 박테리아 및 독소 핵산 시료(Shigella boydii, Shigella dysenteriae type I, Shigella sonnei 2009, Shigella flexneri, Salmonella enterica serovar Typhimurium, Vibrio cholerae O1, Vibrio cholerae O139, Abrin, Brucella melitensis, Francisella tularensis, Botulinum toxin type A, C, D, E, Bacillus anthracis(BA) δSterne, BA HS, BA KJ, BA Sterne, BA 14578, BA HY1) 1×102 pg/μL를 사용하였다.
Table 1.
The multiplex RT-LAMP primer sets used in this study
Toxin (target) Name Sequences (5’ to 3’) Length (mer)
Ricin Ricin_F3 CTTCCTACTAATAATACACAACCTT 25
Ricin_B3 TGTTTCCCGTATATTAGAATCAC 23
Ricin_FIP AGTCCTCTATCCATACTTGTCCACTGACAACCATTGTTGGGCTA 44
Ricin_BIP GCAGTGAAAAGGCTGAACAACAGTGTAAGGCAATTATCTCGGTT 44
Ricin_LF TGCTTGCAAGCACAGAC 17
Ricin_LB TGGGCTCTTTATGCAGATG 19
Ricin_LBP Cy5-GTCAGTGCAGGCTCCCGTGTTAGGACGAGGGTAGGGTAGGTGGGCTC TTTATGCAGATG 55
BoNT-B BoNT-B_F3 GCCAGTTTTAAATGAAAATGAGAC 24
BoNT-B_B3 CTACTTTAATGCCATATAATCCATG 25
BoNT-B_FIP GCTTACATATTCTGGGCAAAACTTCAAAATCATTTTGCATCAAGGGA 47
BoNT-B_BIP TGTTCAAGAAAACAAAGGCGAGTTTCATGCATTAATATCAAGGC 44
BoNT-B_LF CATTATACCCCCGAAGCCT 19
BoNT-B_LB AGTATATTTAATAGACGTGG 20
BoNT-B_LBP HEX-CGGGCCCGTACAAAGGGAACACCCACACTCGTAGGAGTATATTTAA TAGACGTGG 55
SEB SEB_F3 GTTCGGGTATTTGAAGATGG 20
SEB_B3 CAAATTTATCTCCTGGTGCA 20
SEB_FIP CACCAAATAGTGACGAGTTAGGTAAGACGTACAAACTAATAAGAAAAAG 49
SEB_BIP ACTCTATGAATTTAACAACTCGCCTGTCATACCAAAAGCTATTCTCAT 48
SEB_LF TCTAATTCTTGAGCAGTCAC 20
SEB_LB TATGAAACGGGATATATTAAATTTATAG 28
SEB_LBP CGGGCCCGTACAAAGGGAACACCCACACTCGTAGGGTATGAAACGGGAT ATATTAAATTTATAG 55
Quencher Probe BHQ_Probe_1 GAGTGTGGGTGTTCCCTTTGTACGGGCCCG-BHQ1 24
BHQ_Probe_2 CCTACCCTCGTCCTAACACGGGAGCCTGCACTGAC-BHQ2 25

결 과

반응 프라이머 농도 비율과 템플릿 농도는 정적 반응 매트릭스에 노출되었을 때 F3, B3, FIP, BIP, LF, LB 및 LBP가 inner부터 outer 프라이머까지의 비율(2:2:1.75:1.75:5:2:3과 2:2:8:8:4:2:2) 변화를 포함하여 반응성과 감도 최적화를 위해 수행하였다(Fig. 1).
Fig. 1.
Primer optimization of our single reaction RT-LAMP detection assays. Various concentration ratios of each of the primer sets for each of our RT-LAMP assays were evaluated, including changes in the forward: reverse primer ratios for the F3, B3, FIP, BIP, LF, LB and LBP. a) 2:2:1.75:1.75:5:2:3 and b) 2:2:8:8:4:2:2. Red, green, and blue lines indicate Ricin, BoNT-B, and SEB, respectively. ∆Rn(delta Rn): The magnitude of the signal generated under specific PCR conditions, threshold values: The level of determined by the a average standard deviation of Rn during the initial PCR cycles, modified by a factor, and positioned within the exponential amplification phase of PCR products
kimst-27-4-516f1.jpg
결과는 2:2:8:8:4:2:2 비율 혼합이 빠른 반응 속도(임계 값 도달까지의 짧은 시간)와 안정적인 그래프를 보여주었다. 템플릿 농도에 대한 평가는 템플릿이 너무 많은 경우 위양성(false positive)이 발생하고 증폭 효율이 감소할 수 있음이 확인되었다[22,23]. 반응온도 최적 조건은 55 ℃부터 65 ℃까지 범위로 증폭 곡선과 함께 평가하였다. Ricin을 이용하여 최적 반응온도가 57 ℃에서 63 ℃까지 증폭이 가능한 것으로 확인하였다(Fig. 2). 이 데이터를 세부적으로 분석한 결과 증폭 효율이 57 ℃ ∼ 61 ℃에서 점진적으로 증가한 다음 61 ℃ ∼ 63 ℃에서 감소하는 것으로 확인되었다. 또한, 음성 대조군에서는 더 높은 증폭 온도(63 ℃ ∼ 65 ℃)에서 위양성이 약간 증가하고 전반적인 증폭 안정성 및 정확도가 감소하는 것으로 확인되었다. 위의 결과를 통하여 61 ℃의 반응온도가 모든 LAMP 프라이머 세트에서 가장 신뢰할 수 있고 정확한 결과를 보여주는 이상적인 증폭 조건인 것을 확인하였다.
Fig. 2.
Optimizing RT-LAMP assay temperature. Different temperatures(55–65 ℃ at 2 ℃ intervals, a) 55 ℃, b) 57 ℃, c) 59 ℃, d) 61 ℃, e) 63 ℃ and f) 65 ℃) were tested and 61 ℃ was chosen as the optimal temperature for LAMP amplification. ∆Rn(delta Rn): The magnitude of the signal generated under specific PCR conditions, threshold values: The level of determined by the a average standard deviation of Rn during the initial PCR cycles, modified by a factor, and positioned within the exponential amplification phase of PCR products
kimst-27-4-516f2.jpg
표적 유전자를 증폭하기 위해 단일 온도를 사용하는 LAMP 증폭은 임상 시료에서 발견되는 억제제에 의한 영향이 적은 것으로 알려져 있다[24,25]. Ricin, BoNT-B 및 SEB 유전자 RT-LAMP의 민감도는 103 pg/μL 에서 10-2 pg/μL로 희석된 Ricin, BoNT-B 및 SEB 유전자 템플릿을 등온 증폭하여 평가하고 증류수 음성 대조군과 비교했다(Fig. 3). 이 평가는 최적의 조건에서 개발된 프로브 분석이 모두 매우 민감하여 매우 짧은 시간에 정확한 결과를 나타낸다는 것이 확인되었다. RT-LAMP 분석은 3가지 독소에 대해서 10-1 pg/μL만큼 적은 양을 1시간 이내에 증폭할 수 있었다. LAMP의 표준 곡선은 높은 수준의 효능과 민감도를 나타냈다(R2 > 0.96 Ricin, R2 > 0.99 BoNT-B 및 R2 > 0.98 SEB). Ricin, BoNT-B 및 SEB 표적에 대한 검출 한계(LOD)는 각각 1.2×10-2 pg/μL, 5.0×10-3 pg/μL 및 1.7×10-4 pg/μL 로 확인되었다. RT-LAMP 분석은 매우 높은 감도(일반적으로 기존 RT-PCR 방법보다 10∼1,000배 더 높음)와 빠른 검출 속도가 장점으로 알려져 있으며, 두 가지 조건은 현장 진단 환경에서 중요하다[26-28]. 본 연구 결과에서도 RT-LAMP와 RT-PCR과 비교하였을 때 RT-LAMP가 높은 민감도와 빠른 진단 시간의 장점을 보여주었다(Table 2). RT-LAMP는 표적 DNA의 농도가 1.2×10-2 pg/μL부터 1.7×10-4 pg/μL인 조건에서 일정한 온도에서 20∼40분 내 검출이 가능했지만, RT-PCR의 경우 DNA 농도 8.5×100 pg/μL부터 4.4×10-1 pg/μL를 검출하는데 약 2∼3시간(40 cycle)이 소요되었다. 각 실험에는 표준 DNA 템플릿을 사용하여 분석의 교차 반응 가능성을 배제했다. 프라이머의 분석 특이성에 사용한 시료들은 Table 3에 요약하여 정리하였다. Ricin, BoNT-B 및 SEB 외에도 36가지 바이러스, 박테리아 및 독소 핵산(1×102 pg/μL)이 포함되어 있다. 하나의 샘플 튜브에 포함된 36가지의 병원체 핵산 샘플 중에서 Ricin, BoNT-B 및 SEB에 대해서만 반응을 나타냈다. 이러한 결과를 통하여 본 연구의 분석법의 높은 특이성을 확인하였다.
Fig. 3.
Sensitivity evaluation of the RT-LAMP assay. 10-fold serial dilutions of a) Ricin, b) BoNT-B, and c) SEB templates from 103 to 10−2 pg/μL were tested. ∆Rn(delta Rn): The magnitude of the signal generated under specific PCR conditions, threshold values: The level of determined by the a average standard deviation of Rn during the initial PCR cycles, modified by a factor, and positioned within the exponential amplification phase of PCR products
kimst-27-4-516f3.jpg
Table 2.
Comparison RT-LAMP and RT-PCR
property man RT-LAMP RT-PCR
Sensitivity (LOD) Ricin 1.2 × 10-2 pg/μL Ricin 8.5 × 100 pg/μL
BoNT-B 5.0 × 10-3 pg/μL BoNT-B 2.6 × 10-1 pg/μL
SEB 1.7 × 10-4 pg/μL SEB 4.4 × 10-1 pg/μL
Detection time Rapid (requires less than 1 hr) Slow (requires approximately 2∼3 hrs)
Temperature conditions Constant temperature (55-65 ℃) Variable temperature
Cost Cost-effective Expensive
Table 3.
Results of cross-reactivity(specificity) of the multiplex RT-LAMP assay
No Sample Type LAMP mix
1 HTNV_76-118 RNA Undetermined
2 SEOV_80-39 RNA Undetermined
3 PUUV_sotkamo RNA Undetermined
4 SARS-CoV-2 RNA Undetermined
5 SFTSV RNA Undetermined
6 hCoV-OC43 RNA Undetermined
7 JEV RNA Undetermined
8 CoxsakieV RNA Undetermined
9 EchoV RNA Undetermined
10 RhinoV RNA Undetermined
11 Parainfluenza-type1 RNA Undetermined
12 Plasmodium vivax-1 RNA Undetermined
13 Plasmodium vivax-2 RNA Undetermined
14 Plasmodium vivax-3 RNA Undetermined
15 Shigella sonnei 22530 gDNA Undetermined
16 Shigella boydii gDNA Undetermined
17 Shigella dysenteriae type I gDNA Undetermined
18 Shigella sonnei 2009 gDNA Undetermined
19 Shigella flexneri gDNA Undetermined
20 Salmonella enterica Serovar Typhimurium gDNA Undetermined
21 Vibrio cholerae O1 gDNA Undetermined
22 Vibrio cholerae O139 gDNA Undetermined
23 Abrin gDNA Undetermined
24 Brucella melitensis gDNA Undetermined
25 Francisella tularensis gDNA Undetermined
26 Botulinum toxin type A (BoNT/A) gDNA Undetermined
27 Bont/C gDNA Undetermined
28 Bont/D gDNA Undetermined
29 Bont/E gDNA Undetermined
30 Bacillus anthracis (BA) δSterne gDNA Undetermined
31 BA HS gDNA Undetermined
32 BA KJ gDNA Undetermined
33 BA Sterne gDNA Undetermined
34 BA 14578 gDNA Undetermined
35 BA HY1 gDNA Undetermined
36 NTC Undetermined

NTC: Negative template control

다중 표적의 동시 검출은 진단 결과의 특이성과 신뢰성을 저해할 수 있다[29,30]. 이 부분을 고려하여 핵산 가닥 교환 회로를 용이하게 하기 위해 개발된 원리를 적용하여 짧은 반 이중 올리고뉴클레오티드 가닥 변위(Oligonucleotide Strand Displacement, OSD) 프로브를 설계했다[13,31-33]. OSD 프로브는 5′ 또는 3′ 말단에 형광 마커를 포함하는 표적 결합 프로브 및 3′ 또는 5′ 말단에서 소광체로 변형된 두 번째 올리고뉴클레오티드로 2개의 상보적 서열을 포함한다. 표적 결합 프로브는 두 번째 올리고뉴클레오티드보다 10∼11개의 더 긴 염기를 가지고 있어 표적 결합 프로브와 증폭 산물 사이의 결합 엔탈피가 높아져 표적 DNA 증폭 반응이 보다 용이하다[34-36]. 이 증폭은 형광체와 소광체를 분리하여 형광 강도를 증가시킨다. 각 프로브는 서로 다른 염기서열을 식별하고 서로 다른 색상을 통해 나타나기 때문에 OSD 프로브는 다중 RT-LAMP 반응에 매우 적합하다. 다중 RT-LAMP를 사용하여 Ricin, BoNT-B 및 SEB 유전자를 동시에 식별하기 위해 이러한 OSD 프로브를 적용했다. Ricin 특정 OSD 프로브는 Cy5, BoNT-B 특정 OSD 프로브는 HEX, SEB 특정 OSD 프로브는 FAM으로 레이블하여 지정하였다. 프로브는 특정 열역학적 특성으로 인해 각 대상 증폭 산물에 민감하므로 높은 신호로 동일한 반응 내에서 서로 다른 대상을 구별할 수 있다. Fig. 4에서 보이는 것과 같이 OSD 프로브는 각 LAMP 대상을 개별적으로 감지하여 뚜렷한 형광 신호를 생성할 수 있다. 다중 RT-LAMP 분석은 한 개의 튜브에 Ricin(Cy5)/BoNT-B (Hex), BoNT-B(Hex)/SEB(FAM), Ricin(Cy5) SEB(FAM) 및 Ricin(Cy5)/BoNT-B(Hex)/SEB(FAM)의 조합으로 모든 대체 가능한 프로브를 사용하여 검증하였다. 다중 프라이머와 템플릿을 모두 혼합한 실험은 Ricin(Cy5)/BoNT-B(Hex)의 threshold value(Ct 값) 46.84/38.66, BoNT-B(Hex)/SEB(FAM)의 Ct 값 42.05/27.08, Ricin(Cy5)/SEB(FAM)의 Ct 값 45.25/27.13, 및 Ricin(Cy5)/BoNT-B (Hex)/SEB(FAM)의 Ct 값 43.8/34.94/28.63으로 단일 프라이머와 템플릿을 이용한 실험결과(Ricin의 Ct 값 42.05, BoNT-B의 Ct 값 38.94, SEB(FAM)의 Ct 값 26.40)에 비해서 Ct 값이 1∼4 cycle 높게 확인되어 증폭 속도가 늦은 것이 확인되었지만 분석 특이성에는 변화가 없었다. 따라서 교차 반응이나 비특이적 증폭 없이 주형과 프라이머를 혼합하여 사용하더라도 각 표적 유전자의 특이적 증폭이 가능함을 확인할 수 있었다. 또한, 음성 컨트롤 템플릿과도 뚜렷하게 구분되어 다중 타겟 방식으로 인해서 단일 타겟에 비해 민감도가 감소할 수는 있으나 양성 샘플과 음성 샘플을 명확하게 구별할 수 있는 결과를 보여준다[37].
Fig. 4.
Multiplex capabilities of various RT-LAMP assays. Simultaneous detection of a-c) single(Ricin, BoNT-B, and SEB), d-f) duplex(Ricin and BoNT-B, Ricin and SEB, and SEB and BoNT-B), g) triplex(Ricin, BoNT-B, and SEB), h) negative targets for each of our three toxin genes was possible when using our pre-designed multiplex primer sets facilitating single assay detection. ∆Rn(delta Rn): The magnitude of the signal generated under specific PCR conditions, threshold values: The level of determined by the a average standard deviation of Rn during the initial PCR cycles, modified by a factor, and positioned within the exponential amplification phase of PCR products
kimst-27-4-516f4.jpg

결 론

이러한 결과를 통하여 우리가 개발한 RT-LAMP 실험법은 정확성과 특이성을 낮추지 않고 단일 반응에서 3개의 생물학작용제를 식별하기 위해 형광체 결합 프라이머를 사용하여 다중 RT-LAMP의 유용성을 입증하였다. 본 연구의 평가에서는 각 분석 시 온도와 농도 비율의 최적화가 포함되었으며 각 LAMP 반응의 특이성과 민감도를 확인했다. 기존에 활용되고 있는 일반적인 PCR과 실시간 RT-PCR은 해당하는 필수적인 특정 장비가 필요하거나 아가로즈 젤을 통해 확인하는 등의 부가적인 시스템이 필요하므로 탐지 시간과 소요 비용이 증가한다. 한편, LAMP 검출은 일정한 온도에서 등온 반응으로 완료되어 탐지 시간이 절약된다. 이 시스템은 특히 고가의 열 순환 장비(PCR) 없이 다양한 실험실 환경에 쉽게 적용할 수 있어 소요 비용 또한 절약할 수 있다. Ricin, BoNT-B 및 SEB가 생물학작용제 모델로 사용되었으나 이 방법은 다른 세균, 바이러스 또는 독소 표적의 진단을 위해 쉽게 적용할 수 있다. 따라서 이 방법은 여러 표적이 공존할 수 있는 다중 병원체를 성공적으로 식별하여 통합 조사를 가능하게 하여 진단 비용과 시간을 줄이고 보다 정확한 감염 위협 평가 및 예방을 용이하게 할 수 있다.

후 기

본 논문은 2024년 정부의 재원으로 국방과학연구소에서 수행한 연구 결과임(912A01201).

REFERENCES

[1] Scott A. Walper, Guillermo Lasarte Aragones, Kim E. Sapsford, Carl W. Brown III, Clare E. Rowland, Joyce C. Breger and Igor L. Medintz, "Detecting Biothreat Agents: From Current Diagnostics to Developing Sensor Technologies," ACS Sensors, 2018;Vol. 3, pp. 1894–2024.
crossref pmid pdf
[2] M. M. Parida, Paban Kumar Dash and Jyoti Shukla, "Handbook on Biological Warfare Preparedness," "Toxicology," Elsevier, 2020. Vol. 5, p. 83–102.
crossref
[3] Wolfgang F. Klietmann and Kathryn L. Ruoff, "Bioterrorism: Implications for the Clinical Microbiologist," Clinical Microbiology Reviews, 2001;Vol. 2, pp. 364–381.
crossref pmid pmc pdf
[4] Md Eshrat E. Alahi and Subhas Chandra Mukhopadhyay, "Detection Methodologies for Pathogen and Toxins: A Review," Sensors, 2017;Vol. 17, pp. 1885.
crossref pmid pmc
[5] Daniel R. Dahling, "Detection and enumeration of entericviruses in cell culture," Critical Reviews in Environmental Control, 1991;Vol. 21, pp. 237–263.
crossref
[6] Theng-Theng Fong and Erin K. Lipp, "Enteric Viruses of Humans and Animals in Aquatic Environments: Health Risks, Detection, and Potential Water Quality Assessment Tools," Microbiology and Molecular Biology Reviews, 2005;Vol. 69, pp. 357–371.
crossref pmid pmc pdf
[7] S. Notermans and K. Wernars, "Immunological methods for detection of foodbornepathogens and their toxins," International Journal of Food Microbiology, 1991;Vol. 12, pp. 91–102.
crossref pmid
[8] Shailendra Dwivedi, Purvi Purohit, Radhieka Misra, Puneet Pareek, Apul Goel, Sanjay Khattri, Kamlesh Kumar Pant, Sanjeev Misra and Praveen Sharma, "Diseases and Molecular Diagnostics: A Step Closer to Precision Medicine," Indian Journal of Clinical Biochemistry, 2017;Vol. 32, pp. 374–398.
crossref pmid pmc pdf
[9] Julia Engstrom-Melnyk, Pedro L. Rodriguez, Olivier Peraud and Raymond C. Hein, "Clinical Applications of Quantitative Real-Time PCR in Virology," Methods in Microbioogy, 2015;Vol. 42, pp. 161–197.
crossref pmid pmc
[10] Laura Maria Zanoli and Giuseppe Spoto, "Isothermal Amplification Methods for the Detection of Nucleic Acids in Microfluidic Devices," Biosensors, 2013;Vol. 3, pp. 18–43.
crossref pmid
[11] Chia-Chen Chang, Chien-Cheng Chen, Shih-Chung Wei, Hui-Hsin Lu, Yang-Hung Liang and Chii-Wann Lin, "Diagnostic Devices for Isothermal Nucleic Acid Amplification," Sensors, 2012;Vol. 12, pp. 8319–8337.
crossref pmid pmc
[12] BB Oliveira, B Veigas and PV Baptista, "Isothermal Amplification of Nucleic Acids: The Race for the Next “Gold Standard”," Frontiers in Sensors, 2021;Vol. 2, pp. 1–22.
crossref
[13] Lisa Becherer, Nadine Borst, Mohammed Bakheit, Sieghard Frischmann, Roland Zengerle and Felix von Stetten, "Loop-mediated isothermal amplification (LAMP) - review and classification of methods for sequence-specific detection," Analytical Methods, 2020;Vol. 12, pp. 717–746.
crossref
[14] Y.-P. Wong, S. Othman, Y.-L. Lau, S. Radu and H.-Y. Chee, "Loop-mediated isothermal amplification (LAMP): a versatile technique for detection of micro-organisms," Journal of Applied Microbiology, 2017;Vol. 124, pp. 626–643.
crossref pdf
[15] Robin Augustine, Anwarul Hasan, Suvarthi Das, Rashid Ahmed, Yasuyoshi Mori, Tsugunori Notomi, Bhavesh D. Kevadiya and Avnesh S. Thakor, "Loop-Mediated Isothermal Amplification(LAMP): A Rapid, Sensitive, Specific, and Cost-Eective Point-of-Care Test for Coronaviruses in the Context of COVID-19 Pandemic," Biology, 2020;Vol. 9, pp. 182.
crossref pmid pmc
[16] Tamar Berger, Arik Eisenkraft, Erez Bar-Haim, Michael Kassirer, Adi Avniel Aran and Itay Fogel, "Toxins as biological weapons for terror— characteristics, challenges and medical countermeasures: a mini‑ review," Disaster and Military Medicine, 2016;Vol. 2, pp. 7.
crossref pmid pmc
[17] Edyta Janik, Michal Ceremuga, Joanna Saluk-Bijak and Michal Bijak, "Biological Toxins as the Potential Tools for Bioterrorism," International Journal of Molecular Sciences, 2019;Vol. 20, pp. 1181.
crossref pmid pmc
[18] Woong Sik Jang, Da Hye Lim, Jung Yoon, Ahran Kim, Minsup Lim, Jeonghun Nam, Richard Yanagihara, Sook-Won Ryu, Bo Kyeung Jung, Nam-Hee Ryoo and Chae Seung Lim, "Development of a multiplex Loop-Mediated Isothermal Amplification (LAMP) assay for on-site diagnosis of SARS CoV-2," PLoS ONE, 2021;Vol. 16, pp. e0248042.
crossref pmid pmc
[19] Jeeyong Kim, Borae G. Park, Da Hye Lim, Woong Sik Jang, Jeonghun Nam, Do-CiC Mihn and Chae Seung Lim, "Development and evaluation of a multiplexloop-mediated isothermal amplification (LAMP) assay for differentiation of Mycobacterium tuberculosis and nontuberculosis mycobacterium in clinical samples," PLoS ONE, 2021;Vol. 16, pp. e0244753.
crossref pmid pmc
[20] Lan-Lan Zhong, Qian Zhou, Cui-Yan Tan, Adam P Roberts, Mohamed Abd El-Gawad El-Sayed Ahmed, Guanping Chen, Min Dai, Fan Yang, Yong Xia, Kang Liao, Yingjian Liang, Yongqiang Yang, Siyuan Feng, Xiaobin Zheng and Guo-Bao Tian, "Multiplex loop-mediated isothermal amplification (multi-LAMP) assay for rapid detection of mcr-1 to mcr-5 in colistin-resistant bacteria," Infection Drug and Resistance, 2019;Vol. 12, pp. 1877–1887.

[21] Jin Hwa Kim, Minhee Kang, Eunkyoung Park, Doo Ryeon Chung, Jiyeon Kim and Eung Soo Hwang, "A Simple and Multiplex Loop-Mediated Isothermal Amplification(LAMP) Assay for Rapid Detection of SARS-CoV," BioChip Journal, 2019;Vol. 13, pp. 341–351.
crossref pmid pmc pdf
[22] Myungsun Park, Joungha Won, Byung Yoon Choi and C. Justin Lee, "Optimization of primer sets and detection protocols for SARS-CoV-2 of coronavirus disease 2019(COVID-19) using PCR and real-time PCR," Exprimental & Molecular Medicine, 2020;Vol. 52, pp. 963–977.
crossref pdf
[23] Patrick Hardinge, Guy Kiddle, Laurence Tisi and James A. H. Murray, "Optimised LAMP allows single copy detection of 35Sp and NOSt in transgenic maize using Bioluminescent Assay in Real Time (BART)," Scientific Reports, 2018;Vol. 8, pp. 17590.
crossref pmid pmc pdf
[24] Phiaw Chong Foo, A. B. Nurul Najian, Nuramin A. Muhamad, Mariana Ahamad, Maizan Mohamed, Chan Yean Yean and Boon Huat Lim, "Loop-mediated isothermal amplification(LAMP) reaction as viable PCR substitute for diagnostic applications: a comparative analysis study of LAMP, conventional PCR, nested PCR(nPCR) and real-time PCR(qPCR) based on Entamoeba histolytica DNA derived from faecal sample," BMC Biotechnology, 2020;Vol. 20, pp. 34.
crossref pmid pmc pdf
[25] Patrice Francois, Manuela Tangomo, Jonathan Hibbs, Eve-Julie Bonetti, Catharina C Boehme, Tsugunori Notomi, Mark D Perkins and Jacques Schrenzel, "Robustness ofa loop-mediated isothermal amplication reaction for diagnostic applications," FEMS Immunology & Medical Microbiology, 2011;Vol. 62, pp. 41–48.

[26] Mehran Khan, Rongbo Wang, Benjin Li, Peiqing Liu, Qiyong Weng and Qinghe Chen, "Comparative Evaluation of the LAMP Assay and PCR-Based Assays for the Rapid Detection of Alternaria solani," Frontiers in Microbiology, 2018;Vol. 9, pp. 2089.
crossref pmid pmc
[27] Catarina Amaral, Wilson Antunes, Elin Moe, Américo G. Duarte, Luís M. P. Lima, Cristiana Santos, Inês L. Gomes, Gonçalo S. Afonso, Ricardo Vieira, Helena Sofa S. Teles, Marisa S. Reis, Manuel A. Ramalho da Silva, Ana Margarida Henriques, Miguel Fevereiro, M. RitaVentura, Mónica Serranol and Catarina Pimentel, "A molecular test based on RT‑LAMP for rapid, sensitive and inexpensive colorimetric detection of SARS‑CoV‑2 in clinical samples," Scientific Reports, 2021;Vol. 11, pp. 16430.
crossref pmid pmc pdf
[28] Masato Inaba, Yuki Higashimoto, Yoko Toyama, Tomoya Horiguchi, Masaya Hibino, Mitsunaga Iwata, Kazuyoshi Imaizumi and Yohei Doiae, "Diagnostic accuracy of LAMP versus PCR over the course of SARS-CoV-2 infection," International Journal Infectious Diseases, 2021;Vol. 107, pp. 195–200.
crossref
[29] Huseyin Tombuloglu, Hussein Sabit, Ebtesam Al-Suhaimi, Reem Al Jindan and Khaled R. Alkharsah, "Development of multiplex real-time RT-PCR assay for the detection of SARS-CoV-2," PLoS ONE, 2021;Vol. 16, pp. e0250942.
crossref pmid pmc
[30] Ningtao Cheng and Jing Fu, "An Approach to the Simultaneous Detection of Multiple Biomarkers for the Early Diagnosis of Liver Cancer Using Quantum Dot Nanoprobes," Infectious & Microbes Diseases, 2022;Vol. 4, pp. 34–40.
crossref
[31] Yichen Liu, Baiyang Lu, Yidan Tang, Yan Du and Bingling Li, "Real-time gene analysis based on a portable electrochemical microfluidic system," Electrochemistry Communications, 2020;Vol. 111, pp. 106665.
crossref
[32] Patrick Hardinge and James A. H. Murray, "Reduced False Positives and Improved Reporting of Loop-Mediated Isothermal Amplification using Quenched Fluorescent Primers," Scientific Reports, 2019;Vol. 9, pp. 7400.
crossref pmid pmc pdf
[33] Sanchita Bhadra, Timothy E. Riedel, Simren Lakhotia, Nicholas D. Tranc and Andrew D. Ellington, "High-Surety Isothermal Amplification and Detection of SARS-CoV-2," mSphere, 2021;Vol. 6, pp. e00911–20.
crossref pmid pmc pdf
[34] Yu Sherry Jiang, Sanchita Bhadra, Bingling Li, Yuefeng Rose Wu, John N. Milligan and Andrew D. Ellington, "Robust Strand Exchange Reactions for the Sequence-Specific, Real-Time Detection of Nucleic Acid Amplicons," Analytical Chemistry, 2015;Vol. 87, pp. 3314–3320.
crossref pmid
[35] Grégoire Bonnet, Sanjay Tyagi, Albert Libchaber and Fred Russell Kramer, "Thermodynamic basis of the enhanced specificity of structured DNA probes," Proceedings of the National Academy of Sciences of the United States of America, 1999;Vol. 96, pp. 6171–6176.
crossref pmid pmc
[36] Andrew Tsourkas, Mark A. Behlke, Scott D. Rose and Gang Bao, "Hybridization kinetics and thermodynamics of molecular beacons," Nucleic Acids Research, 2003;Vol. 31, pp. 1319–1330.
crossref pmid pmc
[37] Yinhua Zhang and Nathan A Tanner, "Development of Multiplexed Reverse-Transcription Loop-Mediated Isothermal Amplification for Detection of SARS-CoV-2 and Influenza Viral RNA," BioTechniques, 2021;Vol. 70, pp. 167–174.
crossref pmid
TOOLS
Share :
Facebook Twitter Linked In Google+ Line it
METRICS Graph View
  • 0 Crossref
  •    
  • 2,656 View
  • 20 Download
Related articles in J. KIMS Technol.


ABOUT
ARTICLE CATEGORY

Browse all articles >

BROWSE ARTICLES
FOR CONTRIBUTORS
Editorial Office
160 Bugyuseong-daero 488beon-gil, Yuseong-gu, Daejeon 34060, Korea
Tel: +82-42-823-4603    Fax: +82-42-823-4605    E-mail: kimst@kimst.or.kr                

Copyright © 2026 by The Korea Institute of Military Science and Technology.

Developed in M2PI

Close layer
prev next